Review



yfp mcpyv lt  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Addgene inc yfp mcpyv lt
    Yfp Mcpyv Lt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/yfp+mcpyv+lt/pADL*+(Plasmid+%2332097)/pm27580912-149-0-6
    Average 90 stars, based on 2 article reviews
    yfp mcpyv lt - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Replication of Merkel cell polyomavirus induces reorganization of promyelocytic leukemia nuclear bodies.
    Article Snippet: Retroviral plasmids expressing sT or LT were purchased from Addgene, plasmids #37861 and #32862 (Rozenblatt-Rosen et al., 2012). .. YFP-MCPyV LT was cloned from pADL* (Addgene plasmid #32097) with primers containing a NotI restriction side: LT-F: AAGCGGCCGCTTATTGAGAAAAAGTACCAGAATC and LT-R: GCGGCCGCATGGATTTAGTCCTAAATAG into the Clontech vector pYFP-N1. .. Deletion of the stop codon downstream of the YFP tag was performed with the Q5 Site-Directed Mutagenesis kit (NEB) using the following primer sequences: taa_del-F: AGCGGCCGCATGGATTTA and taa_del-R: GTACAGCTCGTCCATGCC.

    Plasmid Preparation:

    Article Title: Replication of Merkel cell polyomavirus induces reorganization of promyelocytic leukemia nuclear bodies.
    Article Snippet: Retroviral plasmids expressing sT or LT were purchased from Addgene, plasmids #37861 and #32862 (Rozenblatt-Rosen et al., 2012). .. YFP-MCPyV LT was cloned from pADL* (Addgene plasmid #32097) with primers containing a NotI restriction side: LT-F: AAGCGGCCGCTTATTGAGAAAAAGTACCAGAATC and LT-R: GCGGCCGCATGGATTTAGTCCTAAATAG into the Clontech vector pYFP-N1. .. Deletion of the stop codon downstream of the YFP tag was performed with the Q5 Site-Directed Mutagenesis kit (NEB) using the following primer sequences: taa_del-F: AGCGGCCGCATGGATTTA and taa_del-R: GTACAGCTCGTCCATGCC.



    Similar Products

    yfp mcpyv lt  (Addgene inc)
    90
    Addgene inc yfp mcpyv lt
    Yfp Mcpyv Lt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/yfp+mcpyv+lt/pADL*+(Plasmid+%2332097)/pm27580912-149-0-6
    Average 90 stars, based on 1 article reviews
    yfp mcpyv lt - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results